The University Wiki Service has upgraded the Confluence Server software, from version 5.9.14 to 5.10.8. Please refer to the knowledge base article, KB0015891, for a high level summary of upgrade changes. Thank you!
Skip to end of metadata
Go to start of metadata

If this page isn't formatted well on your screen, try shrinking the left side bar.

Here is a helpful document from Illumina discussing the compatibility between various library primers and various sequencing platforms and kits.

Canonical ILLUMINA library design as of June 2012 (all 5'-3'), "TruSeq V3": NOTE all sequences shown are TOP STRAND 5' to 3'

<P5 primer/capture site>

<IndexRead2>

<Read1 primer site>

<template - gDNA, RNA, amplicon, whatever>

<Read2 primer site>

<IndexRead1>

<P7 primer/capture site>

If you'd like a different description, this one from the Tufts core facility is quite good.

NOTE THAT THE SHADED PORTIONS SHOULD NOT BE CHANGED if you are designing your own primers!!  The only flexibility one has is in the "template" section and in the two "index read" sections.  Every other nucleotide shown matters as-is.

Single index adaptor design on a standard Illumina HiSeq or MiSeq run
  1. P5 PCR primer/flowcell capture site:

    AATGATACGGCGACCACCGAGA

  2. IndexRead2:

    NONE - as in do NOT put an index here.  If you want to add an index here, use one of the "Dual-index" designs below.

  3. Read1 primer site:

    Either the small RNA sequencing primer site: (NEB: TCTACACGTTCAGAGTTCTACAGTCCGACGATCA [Illumina lists this but it is UNPROVEN: CAGGTTCAGAGTTCTACAGTCCGACGATCA]) OR the standard TruSeq Read 1 primer site: TCTACACTCTTTCCCTACACGACGCTCTTCCGATCT. Which to choose? The TruSeq Read 1 primer site is complementary to the Read 2 primer site, so if you are designing amplicons do NOT use the TruSeq Read 1 primer site, use the small RNA sequencing primer site.

  4. The insert to be sequenced
  5. Read2 primer site:

    Then the Index read primer site: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC (NOTE: the initial A is from the dA tailing of the insert and is not included in the index primer or adaptor sequences; note also the reverse-complement of this is the Read 2 sequencing primer, but the Read 2 sequencing primer includes the T corresponding to the dA insert tail so sequencing starts with the insert)

  6. IndexRead1:

    The index sequence (usually 6 bp) - see many examples below in the Barcodes section. Within a lane, image analysis works best with as much base diversity as possible.

  7. P7 PCR primer/flowcell capture site:

    ATCTCGTATGCCGTCTTCTGCTTG

 

Here is an example of a read-pair from an RNA-seq library generated from the NEB small RNA kit with an insert size of 62 nt:

Read 1 sequence (note adaptor sequence starting with "AGATCGGAA...")
                                       AAGGGATCATAGACGGTATTTCTATGTAAACGAACAGTCGGGCGAGTCTCAGTGGGAGTTTCAGATCGGAAGAGCACACGTCTGAACTCCAGNCACCGATG
ACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCAGGGATCATAGACGGTATTTCTATGTAAACGAACAGTCGGGCGAGTCTCAGTGGGAGTTTC
5' SR adaptor:GUUCAGAGUUCUACAGUCCGACGAUC
Read 2 sequence, reverse complemented (note adaptor sequence RC ending with "...CCGACGATCA")
Dual-index TruSeq (NOT Nextera) adaptor design on a standard Illumina PE HiSeq or MiSeq run
  1. P5 PCR primer/flowcell capture site:

    AATGATACGGCGACCACCGAGATCTACAC

  2. IndexRead2:

    Optional. Example: TAGATCGC. This is called "IndexRead2" because it is read after index read 1. The GSAF does not normally sequence this barcode - please request if you need it read. We have little guidance to offer on designs other than to re-use the same sequences as in the Index Read 1 site - base diversity is your friend.

  3. Read1 primer site:

    The standard TruSeq Read 1 primer site: ACACTCTTTCCCTACACGACGCTCTTCCGATCT. We are not sure at this point whether the small RNA primer site is compatible with dual-indexes or not.

  4. The remaining template elements are identical to the Single-index adaptor design above.
  5. Note that an artifact of this design is that a SINGLE index (I7 index) TS library will read the sequence "TCTTTC..." as the I5 index if it is run in dual-index mode. 
Dual-index Nextera adaptor design (we believe these are compatible with Illumina V3 PE HiSeq or V2/V3 MiSeq run)
Nextera® DNA Sample Preparation Kit (Illumina) 1,2
Nextera® transposase sequences (FC-121-1031, FC-121-1030)
5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
                      (a) Read 1 -->
5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
                       (d) Read 2 -->

Nextera® Index Kit - PCR primers (FC-121-1012, FC-121-1011)
5’ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
           (c) i5 Index read -->
5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
                               <-- i7 Index read (b)

Nextera codes for entry on sample sheet:

i5 bases in adapter

Nextera DNA i5 index name

Nextera XT i5 index name

Nextera Enrichment i5 index name

HiSeq 2500 and MiSeq i5 bases

for entry on sample sheet

NextSeq and HiSeq 4000 i5 bases

for entry on sample sheet

TAGATCGC

N501

S501

E501

TAGATCGC

GCGATCTA

CTCTCTAT

N502

S502

E502

CTCTCTAT

ATAGAGAG

TATCCTCT

N503

S503

E503

TATCCTCT

AGAGGATA

AGAGTAGA

N504

S504

E504

AGAGTAGA

TCTACTCT

GTAAGGAG

N505

S505

E505

GTAAGGAG

CTCCTTAC

ACTGCATA

N506

S506

E506

ACTGCATA

TATGCAGT

AAGGAGTA

N507

S507

E507

AAGGAGTA

TACTCCTT

CTAAGCCT

N508

S508

E508

CTAAGCCT

AGGCTTAG

i7 bases in adapter

Nextera DNA i7 index name

Nextera XT i7 index name

Nextera Enrichment i7 index name

i7 bases for entry on sample sheet (HiSeq, MiSeq, or NextSeq)

TCGCCTTA

N701

N701

N701

TAAGGCGA

CTAGTACG

N702

N702

N702

CGTACTAG

TTCTGCCT

N703

N703

N703

AGGCAGAA

GCTCAGGA

N704

N704

N704

TCCTGAGC

AGGAGTCC

N705

N705

N705

GGACTCCT

CATGCCTA

N706

N706

N706

TAGGCATG

GTAGAGAG

N707

N707

N707

CTCTCTAC

CCTCTCTG

N708

N708

N708

CAGAGAGG

AGCGTAGC

N709

N709

N709

GCTACGCT

CAGCCTCG

N710

N710

N710

CGAGGCTG

TGCCTCTT

N711

N711

N711

AAGAGGCA

TCCTCTAC

N712

N712

N712

GTAGAGGA

Barcodes (also known as Indexes)

NOTE: Illumina barcodes (indexes) have varied significantly over time NOT ONLY in their sequence but also in WHERE they are placed in the sequencing construct.

The GSAF expects indexes to be in the 3' end of the final sequencing construct, between the Index read sequencing primer site and the P7 PCR primer site. If you are using dual-indexed samples with an additional barcode between the P5 bridge PCR primer site and the Read 1 sequencing primer site, we can easily accommodate that on a run but do not normally do so - you need to tell us.

The GSAF uses the following names for the following barcodes. Note that these sequences are shown 5'-3' when the P5 sequence is on the left. In other words, here is the first barcode shown in the context of the full 3'-end adaptor construct:
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

Sequence

TruSeq name

NEXTFlex number

ATCACG

TSBC01

NFBC07

CGATGT

TSBC02

NFBC01

TTAGGC

TSBC03

NFBC08

TGACCA

TSBC04

NFBC02

ACAGTG

TSBC05

NFBC03

GCCAAT

TSBC06

NFBC04

CAGATC

TSBC07

NFBC05

ACTTGA

TSBC08

NFBC09

GATCAG

TSBC09

NFBC10

TAGCTT

TSBC10

NFBC11

GGCTAC

TSBC11

NFBC12

CTTGTA

TSBC12

NFBC06

AGTCAA

TSBC13

NFBC13

AGTTCC

TSBC14

NFBC14

ATGTCA

TSBC15

NFBC15

CCGTCC

TSBC16

NFBC16

GTAGAG

TSBC17

NFBC17

GTCCGC

TSBC18

NFBC18

GTGAAA

TSBC19

NFBC19

GTGGCC

TSBC20

NFBC20

GTTTCG

TSBC21

NFBC21

CGTACG

TSBC22

NFBC22

GAGTGG

TSBC23

NFBC23

GGTAGC

TSBC24

NFBC24

ACTGAT

TSBC25

NFBC25

ATGAGC

TSBC26

NFBC26

ATTCCT

TSBC27

NFBC27

CAAAAG

TSBC28

NFBC28

CAACTA

TSBC29

NFBC29

CACCGG

TSBC30

NFBC30

CACGAT

TSBC31

NFBC31

CACTCA

TSBC32

NFBC32

CAGGCG

TSBC33

NFBC33

CATGGC

TSBC34

NFBC34

CATTTT

TSBC35

NFBC35

CCAACA

TSBC36

NFBC36

CGGAAT

TSBC37

NFBC37

CTAGCT

TSBC38

NFBC38

CTATAC

TSBC39

NFBC39

CTCAGA

TSBC40

NFBC40

GACGAC

TSBC41

N/A

GCGCTA

N/A

NFBC41

TAATCG

TSBC42

NFBC42

TACAGC

TSBC43

NFBC43

TATAAT

TSBC44

NFBC44

TCATTC

TSBC45

NFBC45

TCCCGA

TSBC46

NFBC46

TCGAAG

TSBC47

NFBC47

TCGGCA

TSBC48

NFBC48

NOTE that TSBC41 is hamming distance 2 away from both TSBC31 and TSBC11; all others are hamming distance >=3.

Some additional 5 bp barcodes can be found here:http://comailab.genomecenter.ucdavis.edu/index.php/Barcodes

After exhaustive searching of all 4096 6-mers, the following table is all remaining 6 bp barcodes that have hamming distance of at least 3 from each other and the table above of 49 barcodes (NOTE: these have NOT been tested on the sequencer as of 2/7/12):

Sequence

GSAF name

 

AAACAC

UTBC50

 

TGAAGG

UTBC51

 

AACATA

UTBC52

 

CGCGTC

UTBC53

 

GATACA

UTBC54

 

GGTGTG

UTBC55

 

TAAGAA

UTBC56

 

AGCGAG

UTBC57

 

CGGTTA

UTBC58

 

AGCTTT

UTBC59

 

TGGTCT

UTBC60

 

TATCCC

UTBC61

 

TGTCGT

UTBC62

 

CCCCAC

UTBC63

 

ATACGA

UTBC64

 

CCCTTG

UTBC65

 

ACCGGC

UTBC66

 

TTACTG

UTBC67

 

GGAACT

UTBC68

 

GTTATT

UTBC69

 

AAAAGT

UTBC70

 

AAGGGA

UTBC71

 

AAGTAT

UTBC72

 

ACATCT

UTBC73

 

ACGATT

UTBC74

 

ACGCCG

UTBC75

 

ACTCTC

UTBC76

 

AGAATC

UTBC77

 

ATTGGG

UTBC78

 

CCGCGT

UTBC79

 

CGCCCT

UTBC80

 

CTGCAG

UTBC81

 

GAAGTT

UTBC82

 

GCACCC

UTBC83

 

GCAGGA

UTBC84

 

GCCGCG

UTBC85

 

GGCGGT

UTBC86

 

GTATTA

UTBC87

 

TACGTG

UTBC88

 

TCACAT

UTBC89

 

TCTATA

UTBC90

 

TGCAAA

UTBC91

 

TGGCAC

UTBC92

 

TGTTAG

UTBC93

 

TTCTAT

UTBC94

 

Excruciating details - USE WITH CAUTION - RNA PCR primers are NOT current as of Dec. 2011

Oligonucleotide sequences for TruSeqTM RNA and DNA Sample Prep Kits1

TruSeq Universal Adapter
     5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

TruSeq Adapters
barcode:                            ATCACG
TruSeq Adapter, Index 1
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 2
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 3
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 4
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 5
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 6
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 7
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 8
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 9
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 10
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 11
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 12
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC Mux index read seq primer
  AGATCGGAAGAGCACACGTCTG - my 3' adaptor
my RT primer:
5' TCAGACGTGTGCTCTTCCGATCT 3'
  TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG Mux read 2 seq primer (reversed)
                       CTTGAGGTCAGTGGAACATTAGAGCATACGGCAGAAGACGAAC Index 12 PCR primer (reversed)
So order RC of TruSeq Adaptor Indexes as PCR primers

Oligonucleotide sequences for TruSeq Small RNA Sample Prep Kits
*****************************
Example (all Illumina sequences unless noted):
RNA PCR Primer (RP1),  part # 15005505
5’ AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA
   AATGATACGGCGACCACCGA      CAGGTTCAGAGTTCTACAGTCCGA - this is the NEB SR Primer R1 - pads added by SPHS
                 5' RNA adaptor GUUCAGAGUUCUACAGUCCGACGAUC  (NEB kit calls this the SR Adaptor 1)

RNA PCR Primer, Index 1 (RPI1) code ATCACG in DNA, RC (CGTGAT)
5' CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA 3' - RNA pcr primer
   CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (RC of DNA Index 1 for comparison)
                        3' RNA adaptor   3'  CCTTGGCACCCGAGAATTCCA - 5'
*****************************
Differences with NEB Small RNA kit (RP1/SR Primer R1/SR Adaptor 1/5' RNA adaptor are all the same):
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG  (TruSeq Adaptor Ind 12)
 NEB 3' adaptor (3' SR Adaptor 1)       5'  ATCGTATGCCGTCTTCTGCTTG 3'
                                       3'    AGCATACGGCAGAAGACGAAC 5' (reverse of NEB SR Primer F1)
3' CTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGCCGATGTAGAGCATACGGCAGAAGACGAAC 5' (rev. of Ind. 12 adaptor)
CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTC (TruSeq Adaptor Ind 12 PCR primer)
5' CAAGCAGAAGACGGCATACGA 3' (NEB SR Primer F1)
5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT   (Illumina genomic PCR primer)
3' CAAGCAGAAGACGGCATACGAT 5' - NEB 3' SR Adaptor 1 (RC)
5' CAAGCAGAAGACGGCATACGA 3' - NEB RT Primer 1
For reference:
>TruSeqAdapterIndex11_RC
CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
>TruSeqAdapterIndex12_RC
CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
*****************************

RNA 5’ Adapter (RA5),  part # 15013205
5’ GUUCAGAGUUCUACAGUCCGACGAUC

RNA 3’ Adapter (RA3),  part # 15013207
5’ TGGAATTCTCGGGTGCCAAGG
3' ACCTTAAGAGCCCACGGTTCCG 5' (RT primer, reversed)

RNA RT Primer (RTP),  part # 15013981
5’ GCCTTGGCACCCGAGAATTCCA

Multiplexing Index Read Sequencing Primer
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Multiplexing Read 2 Sequencing Primer
5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
RNA PCR Primer (RP1),  part # 15005505
5’ AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA
RNA PCR Primer, Index 1 (RPI1)
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 2 (RPI2)
CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 3 (RPI3)
CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 4 (RPI4)
CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 5 (RPI5)
CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 6 (RPI6)
CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 7 (RPI7)
CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 8 (RPI8)
CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 9 (RPI9)
CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 10 (RPI10)
CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 11 (RPI11)
CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 12 (RPI12)
CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 13 (RPI13)
CAAGCAGAAGACGGCATACGAGATTTGACTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 14 (RPI14)
CAAGCAGAAGACGGCATACGAGATGGAACTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 15 (RPI15)
CAAGCAGAAGACGGCATACGAGATTGACATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 16 (RPI16)
CAAGCAGAAGACGGCATACGAGATGGACGGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 17 (RPI17)
CAAGCAGAAGACGGCATACGAGATCTCTACGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 18 (RPI18)
CAAGCAGAAGACGGCATACGAGATGCGGACGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 19 (RPI19)
CAAGCAGAAGACGGCATACGAGATTTTCACGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 20 (RPI20)
CAAGCAGAAGACGGCATACGAGATGGCCACGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 21 (RPI21)
CAAGCAGAAGACGGCATACGAGATCGAAACGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 22 (RPI22)
CAAGCAGAAGACGGCATACGAGATCGTACGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 23 (RPI23)
CAAGCAGAAGACGGCATACGAGATCCACTCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 24 (RPI24)
CAAGCAGAAGACGGCATACGAGATGCTACCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 25 (RPI25)
CAAGCAGAAGACGGCATACGAGATATCAGTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 26 (RPI26)
CAAGCAGAAGACGGCATACGAGATGCTCATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 27 (RPI27)
CAAGCAGAAGACGGCATACGAGATAGGAATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 28 (RPI28)
CAAGCAGAAGACGGCATACGAGATCTTTTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 29 (RPI29)
CAAGCAGAAGACGGCATACGAGATTAGTTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 30 (RPI30)
CAAGCAGAAGACGGCATACGAGATCCGGTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 31 (RPI31)
CAAGCAGAAGACGGCATACGAGATATCGTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 32 (RPI32)
CAAGCAGAAGACGGCATACGAGATTGAGTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 33 (RPI33)
CAAGCAGAAGACGGCATACGAGATCGCCTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 34 (RPI34)
CAAGCAGAAGACGGCATACGAGATGCCATGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 35 (RPI35)
CAAGCAGAAGACGGCATACGAGATAAAATGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 36 (RPI36)
CAAGCAGAAGACGGCATACGAGATTGTTGGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 37 (RPI37)
CAAGCAGAAGACGGCATACGAGATATTCCGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 38 (RPI38)
CAAGCAGAAGACGGCATACGAGATAGCTAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 39 (RPI39)
CAAGCAGAAGACGGCATACGAGATGTATAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 40 (RPI40)
CAAGCAGAAGACGGCATACGAGATTCTGAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 41 (RPI41)
CAAGCAGAAGACGGCATACGAGATGTCGTCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 42 (RPI42)
CAAGCAGAAGACGGCATACGAGATCGATTAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 43 (RPI43)
CAAGCAGAAGACGGCATACGAGATGCTGTAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 44 (RPI44)
CAAGCAGAAGACGGCATACGAGATATTATAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 45 (RPI45)
CAAGCAGAAGACGGCATACGAGATGAATGAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 46 (RPI46)
CAAGCAGAAGACGGCATACGAGATTCGGGAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 47 (RPI47)
CAAGCAGAAGACGGCATACGAGATCTTCGAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
RNA PCR Primer, Index 48 (RPI48)
CAAGCAGAAGACGGCATACGAGATTGCCGAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA


Oligonucleotide sequences for Genomic DNA

Adapters
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
PCR Primers
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT

Genomic DNA Sequencing Primer
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT


Paired End DNA oligonucleotide sequences

PE Adapters
5' P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE PCR Primer 1.0
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE PCR Primer 2.0
5' CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

PE Read 1 Sequencing Primer
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE Read 2 Sequencing Primer
5' CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT


Oligonucleotide sequences for the Multiplexing Sample Prep Oligo Only Kit

Multiplexing Adapters
5' P-GATCGGAAGAGCACACGTCT
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Multiplexing PCR Primer 1.0
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Multiplexing PCR Primer 2.0

Multiplexing Read 1 Sequencing Primer
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Multiplexing Index Read Sequencing Primer
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Multiplexing Read 2 Sequencing Primer
5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

PCR Primer, Index 1
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTC
PCR Primer, Index 2
CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTC
PCR Primer, Index 3
CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTC
PCR Primer, Index 4
CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTC
PCR Primer, Index 5
CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTC
PCR Primer, Index 6
CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTC
PCR Primer, Index 7
CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTC
PCR Primer, Index 8
CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTC
PCR Primer, Index 9
CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTC
PCR Primer, Index 10
CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTC
PCR Primer, Index 11
CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTC
PCR Primer, Index 12
CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTC

Oligonucleotide sequences © 2007-2012 Illumina, Inc. All rights reserved. 
Derivative works created by Illumina customers are authorized for use with Illumina 
instruments and products only. All other uses are strictly prohibited.
Nextera adaptor style:

 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGT-3'
                  |||||||||||||||||||
3'-CAGAGCACCCGAGCCTCTACACATATTCTCTGTC-5'

TruSeq truncated adaptor:
  5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
                         |||||||||||||
 3'-CACTGACCTCAAGTCTGCACACGAGAAGGCTAGA-5'

Nextera adaptor style, with primers overlaid:
First cycle:
                                                                                                            3'-GGCTCGGGTGCTCTG CAAAGC TAGAGCATACGGCAGAAGACGAAC-5'
                                  5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGT-3'   <UNKNOWN>   5'-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3'
                                                   |||||||||||||||||||                      |||||||||||||||||||
                                 3'-CAGAGCACCCGAGCCTCTACACATATTCTCTGTC-5'    <UNKNOWN>  3'-TGACAGAGAATATGTGTAGACTGCGACGGCTGCT-5'


Second and subsequent cycles:
AATGATACGGCGACCACCGAGATCTACAC ATCACG TCGTCGGCAGCGTC
                                  3'-AGCAGCCGTCGCAGTCTACACATATTCTCTGTCA   <UNKNOWN>  3'-TGACAGAGAATATGTGTAGACTGCGACGGCTGCT-5'

 

Cautions, common mistakes, and lessons learned from failure

  1. Assembling the P7 side adaptor or primer wrong - the key thing to note is that the "cannonical designs" are shown 5' to 3' across the entire finished sequencing construct.  So if you're designing a reverse primer for the P7 side you have to use the reverse complement of ALL 3 DESIGN ELEMENTS (flow cell binding site, barcode, and sequencing primer site) and make sure they're in the right order.
  2. Incorrect P5 dual-index design - the "ACAC" motif in the single index design MUST be repeated on both sides of an index within P5 - see the "dual index" designs specifically.
  3. Reverse complement barcode sequences in either P5 or P7 side indexes, especially from amplicons - the fact that the Illumina sequencers read i5 differently is a pain - pay attention to that when submitting barcode sequences that will wind up in a sample sheet.  And remember that the i7 index is read "forward, top strand" of the canonical design, which is reverse complement of the sequence that appears in a reverse primer used when creating a library.

 

  • No labels