Code Block |
---|
language | bash |
---|
title | solution code |
---|
| module load bedtools
bedtools bamtofastq -i yeast_pairedend_sort.mapped.q1.bam -fq yeast_pairedend_sort.mapped.q1.fastq #takes 1-2 minutes
more yeast_pairedend_sort.mapped.q1.fastq |
Here is an example of two sequences (and their corresponding quality scores): Code Block |
---|
language | bash |
---|
title | two lines of a fastq file |
---|
| @HWI-ST1097:127:C0W5VACXX:5:2212:10568:79659
TACCCTCCAATTACCCATATCCAACCCACTGCCACTTACCCTACCATTACCCTACCATCCACCATGACCTACTCACCATACTGTTCTTCTACCCACCATAT
+
CCCFFFFFHHHHHJJJJJIIJJJJIJJIJJIJJIIIIJJJIJJIJJIJJIJJJJJJJJJJIIGGIGEGAEHFEFFEFFFDEEE@CCEDCDDD>ACBBDCA@
@HWI-ST1097:127:C0W5VACXX:5:2115:19940:13862
TAGGGTAAGTTTGAGATGGTATATACCCTACCATCCACCATGACCTACTCACCATACTGTTCTTCTACCCACCATATTGAAACGCTAACAAATGATCGTAA
+
?B@DF2ADHFHHFHJIIIGCIHIGGIJJJJGHIIIGIJEHHIGGGAHEGGFGHIECGIJIIIJIIIIIJJJJJJE>EHDHEEEBCDD?CDDBDDDDDDCDB |
As we discussed earlier, the top line is the identifier for the sequence produced, the second line defines which bases were produced, the third line indicates the strand the sequence is aligned to, and the fourth line indicates the ASCII based quality scores for each character in the second line. |