Page History

...

We can quickly index the references for the yeast genome, the human miRNAs, and the V. cholerae genome, because they are all small, so we'll build each index from the appropriate FASTA files right before we use them. 

/work/projects/BioITeam/projects/courses/Core_NGS_Tools/references/sacCer3.fa
/work/projects/BioITeam/projects/courses/Core_NGS_Tools/references/hairpin_cDNA_hsa.fa

hg19 is way too big for us to index here so we will use an existing set of BWA hg19 index files located at:

...

/work/projects/BioITeam/ref_genome/
   bowtie2/
   bwa/
   hisat2/
   kallisto/
   star/
   tophat/

Exercise #1: BWA global alignment – Yeast ChIP-seq

Overview ChIP-seq alignment workflow with BWA

We will perform a global alignment of the paired-end Yeast ChIP-seq sequences using bwa. This workflow has the following steps:

1. Trim the FASTQ sequences down to 50 with fastx_clipper
   • this removes most of any 5' adapter contamination without the fuss of specific adapter trimming w/cutadapt
2. Prepare the sacCer3 reference index for bwa using bwa index
   
   • this is done once, and re-used for later alignments
3. Perform a global bwa alignment on the R1 reads (bwa aln) producing a BWA-specific binary .sai intermediate file
4. Perform a global bwa alignment on the R2 reads (bwa aln) producing a BWA-specific binary .sai intermediate file
5. Perform pairing of the separately aligned reads and report the alignments in SAM format using bwa sampe
6. Convert the SAM file to a BAM file (samtools view)
7. Sort the BAM file by genomic location (samtools sort)
8. Index the BAM file (samtools index)
9. Gather simple alignment statistics (samtools flagstat and samtools idxstat)

We're going to skip the trimming step for now and see how it goes. We'll perform steps 2 - 5 now and leave samtools for a later exercise since steps 6 - 10 are common to nearly all post-alignment workflows.

Introducing BWA

Like other tools you've worked with so far, you first need to load bwa. Do that now, and then enter bwa with no arguments to view the top-level help page (many NGS tools will provide some help when called with no arguments). Note that bwa is available both from the standard TACC module system and as BioContainers. module.

module load bwa
bwa

Program: bwa (alignment via Burrows-Wheeler transformation)
Version: 0.7.16a-r1181
Contact: Heng Li <lh3@sanger.ac.uk>

Usage:   bwa <command> [options]

Command: index         index sequences in the FASTA format
         mem           BWA-MEM algorithm
         fastmap       identify super-maximal exact matches
         pemerge       merge overlapping paired ends (EXPERIMENTAL)
         aln           gapped/ungapped alignment
         samse         generate alignment (single ended)
         sampe         generate alignment (paired ended)
         bwasw         BWA-SW for long queries

         shm           manage indices in shared memory
         fa2pac        convert FASTA to PAC format
         pac2bwt       generate BWT from PAC
         pac2bwtgen    alternative algorithm for generating BWT
         bwtupdate     update .bwt to the new format
         bwt2sa        generate SA from BWT and Occ

Note: To use BWA, you need to first index the genome with `bwa index'.
      There are three alignment algorithms in BWA: `mem', `bwasw', and
      `aln/samse/sampe'. If you are not sure which to use, try `bwa mem'
      first. Please `man ./bwa.1' for the manual.

As you can see, bwa include many sub-commands that perform the tasks we are interested in.

Building the BWA sacCer3 index

We will index the genome with the bwa index command. Type bwa index with no arguments to see usage for this sub-command.

Usage:   bwa index [options] <in.fasta>

Options: -a STR    BWT construction algorithm: bwtsw, is or rb2 [auto]
         -p STR    prefix of the index [same as fasta name]
         -b INT    block size for the bwtsw algorithm (effective with -a bwtsw) [10000000]
         -6        index files named as <in.fasta>.64.* instead of <in.fasta>.*

Warning: `-a bwtsw' does not work for short genomes, while `-a is' and
         `-a div' do not work not for long genomes.

Based on the usage description, we only need to specify two things:

• The name of the FASTA file  
• Whether to use the bwtsw or is algorithm for indexing

Since sacCer3 is relative large (~12 Mbp) we will specify bwtsw as the indexing option (as indicated by the "Warning" message), and the name of the FASTA file is sacCer3.fa.

The output of this command is a group of files that are all required together as the index. So, within our references directory, we will create another directory called references/bwa/sacCer3 and build the index there. To remind ourselves which FASTA was used to build the index, we create a symbolic link to our references/fasta/sacCer3.fa file (note the use of the ../.. relative path syntax).

mkdir -p $SCRATCH/core_ngs/alignment/fastq
mkdir -p $SCRATCH/core_ngs/references/fasta
cp $CORENGS/alignment/*fastq.gz $SCRATCH/core_ngs/alignment/fastq/
cp $CORENGS/references/*.fa $SCRATCH/core_ngs/references/fasta/

mkdir -p $SCRATCH/core_ngs/references/bwa/sacCer3
cd $SCRATCH/core_ngs/references/bwa/sacCer3
ln -s ../../fasta/sacCer3.fa
ls -l

Now execute the bwa index command.

bwa index -a bwtsw sacCer3.fa

Since the yeast genome is not large when compared to human, this should not take long to execute (otherwise we would do it as a batch job). When it is complete you should see a set of index files like this:

sacCer3.fa
sacCer3.fa.amb
sacCer3.fa.ann
sacCer3.fa.bwt
sacCer3.fa.pac
sacCer3.fa.sa

Exploring the FASTA with grep

It is often useful to know what chromosomes/contigs are in a FASTA file before you start an alignment so that you're familiar with the contig naming convention – and to verify that it's the one you expect.  For example, chromosome 1 is specified differently in different references and organisms: chr1 (USCS human), chrI (UCSC yeast), or just 1 (Ensembl human GRCh37).

A FASTA file consists of a number of contig name entries, each one starting with a right carat ( > ) character, followed by many lines of base characters. E.g.:

>chrI
CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACC
CACACACACACATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTG
GCCAACCTGTCTCTCAACTTACCCTCCATTACCCTGCCTCCACTCGTTAC
CCTGTCCCATTCAACCATACCACTCCGAACCACCATCCATCCCTCTACTT

How do we dig out just the lines that have the contig names and ignore all the sequences? Well, the contig name lines all follow the pattern above, and since the > character is not a valid base, it will never appear on a sequence line.

We've discovered a pattern (also known as a regular expression) to use in searching, and the command line tool that does regular expression matching is grep (general regular expression parser). Read more about grep here: Advanced commands: grep.

Regular expressions are so powerful that nearly every modern computer language includes a "regex" module of some sort. There are many online tutorials for regular expressions, and several slightly different "flavors" of them. But the most common is the Perl style (http://perldoc.perl.org/perlretut.html), which was one of the fist and still the most powerful (there's a reason Perl was used extensively when assembling the human genome). We're only going to use the most simple of regular expressions here, but learning more about them will pay handsome dividends for you in the future.

Here's how to execute grep to list contig names in a FASTA file.

grep -P '^>' sacCer3.fa | more

Notes:

• The -P option tells grep to Perl-style regular expression patterns.
  
  • This makes including special characters like Tab ( \t ), Carriage Return ( \r ) or Linefeed ( \n ) much easier that the default POSIX paterns.
  • While it is not required here, it generally doesn't hurt to include this option.

• '^>' is the regular expression describing the pattern we're looking for (described below)

• sacCer3.fa is the file to search.
  
  • lines with text that match our pattern will be written to standard output
  • non matching lines will be omitted
• We pipe to more just in case there are a lot of contig names.

Now down to the nuts and bolts of the pattern: '^>'

First, the single quotes around the pattern – this tells the bash shell to pass the exact string contents to grep.

As part of its friendly command line parsing and evaluation, the shell will often look for special characters on the command line that mean something to it (for example, the $ in front of an environment variable name, like in $SCRATCH). Well, regular expressions treat the $ specially too – but in a completely different way! Those single quotes tell the shell "don't look inside here for special characters – treat this as a literal string and pass it to the program". The shell will obey, will strip the single quotes off the string, and will pass the actual pattern, ^>, to the grep program. (Note that the shell does look inside double quotes ( " ) for certain special signals, such as looking for environment variable names to evaluate. Read more about Quoting in the shell.)

So what does ^> mean to grep? We know that contig name lines always start with a > character, so > is a literal for grep to use in its pattern match.

We might be able to get away with just using this literal alone as our regex, specifying '>' as the command line argument. But for grep, the more specific the pattern, the better. So we constrain where the > can appear on the line. The special carat ( ^ ) character represents "beginning of line". So ^> means "beginning of a line followed by a > character".

Exercise: How many contigs are there in the sacCer3 reference?

Exploring FASTA with grep

It is often useful to know what chromosomes/contigs are in a FASTA file before you start an alignment so that you're familiar with the contig naming convention – and to verify that it's the one you expect.  For example, chromosome 1 is specified differently in different references and organisms: chr1 (USCS human), chrI (UCSC yeast), or just 1 (Ensembl human GRCh37).

A FASTA file consists of a number of contig name entries, each one starting with a right carat ( > ) character, followed by many lines of base characters. E.g.:

>chrI
CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACC
CACACACACACATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTG
GCCAACCTGTCTCTCAACTTACCCTCCATTACCCTGCCTCCACTCGTTAC
CCTGTCCCATTCAACCATACCACTCCGAACCACCATCCATCCCTCTACTT

How do we dig out just the lines that have the contig names and ignore all the sequences? Well, the contig name lines all follow the pattern above, and since the > character is not a valid base, it will never appear on a sequence line.

We've discovered a pattern (also known as a regular expression) to use in searching, and the command line tool that does regular expression matching is grep (general regular expression parser). Read more about grep here: Advanced commands: grep.

Regular expressions are so powerful that nearly every modern computer language includes a "regex" module of some sort. There are many online tutorials for regular expressions, and several slightly different "flavors" of them. But the most common is the Perl style (http://perldoc.perl.org/perlretut.html), which was one of the fist and still the most powerful (there's a reason Perl was used extensively when assembling the human genome). We're only going to use the most simple of regular expressions here, but learning more about them will pay handsome dividends for you in the future.

Here's how to execute grep to list contig names in a FASTA file.

grep -P '^>' sacCer3.fa | more

Notes:

• The -P option tells grep to Perl-style regular expression patterns. 
  
  • This makes including special characters like Tab ( \t ), Carriage Return ( \r ) or Linefeed ( \n ) much easier that the default POSIX paterns.
  • While it is not required here, it generally doesn't hurt to include this option.

• '^>' is the regular expression describing the pattern we're looking for (described below)

• sacCer3.fa is the file to search. 
  
  • lines with text that match our pattern will be written to standard output
  • non matching lines will be omitted
• We pipe to more just in case there are a lot of contig names.

Now down to the nuts and bolts of the pattern: '^>'

First, the single quotes around the pattern – this tells the bash shell to pass the exact string contents to grep.

As part of its friendly command line parsing and evaluation, the shell will often look for special characters on the command line that mean something to it (for example, the $ in front of an environment variable name, like in $SCRATCH). Well, regular expressions treat the $ specially too – but in a completely different way! Those single quotes tell the shell "don't look inside here for special characters – treat this as a literal string and pass it to the program". The shell will obey, will strip the single quotes off the string, and will pass the actual pattern, ^>, to the grep program. (Note that the shell does look inside double quotes ( " ) for certain special signals, such as looking for environment variable names to evaluate. Read more about Quoting in the shell.)

So what does ^> mean to grep? We know that contig name lines always start with a > character, so > is a literal for grep to use in its pattern match.

We might be able to get away with just using this literal alone as our regex, specifying '>' as the command line argument. But for grep, the more specific the pattern, the better. So we constrain where the > can appear on the line. The special carat ( ^ ) character represents "beginning of line". So ^> means "beginning of a line followed by a > character".

Exercise: How many contigs are there in the sacCer3 reference?

grep -P '^>' sacCer3.fa | wc -l

grep -P -c '^>' sacCer3.fa

Exercise #1: BWA global alignment – Yeast ChIP-seq

Overview ChIP-seq alignment workflow with BWA

We will perform a global alignment of the paired-end Yeast ChIP-seq sequences using bwa. This workflow has the following steps:

1. Trim the FASTQ sequences down to 50 with fastx_clipper
   • this removes most of any 5' adapter contamination without the fuss of specific adapter trimming w/cutadapt
2. Prepare the sacCer3 reference index for bwa using bwa index
   
   • this is done once, and re-used for later alignments
3. Perform a global bwa alignment on the R1 reads (bwa aln) producing a BWA-specific binary .sai intermediate file
4. Perform a global bwa alignment on the R2 reads (bwa aln) producing a BWA-specific binary .sai intermediate file
5. Perform pairing of the separately aligned reads and report the alignments in SAM format using bwa sampe
6. Convert the SAM file to a BAM file (samtools view)
7. Sort the BAM file by genomic location (samtools sort)
8. Index the BAM file (samtools index)
9. Gather simple alignment statistics (samtools flagstat and samtools idxstat)

We're going to skip the trimming step for now and see how it goes. We'll perform steps 2 - 5 now and leave samtools for a later exercise since steps 6 - 10 are common to nearly all post-alignment workflows.

Introducing BWA

Like other tools you've worked with so far, you first need to load bwa. Do that now, and then enter bwa with no arguments to view the top-level help page (many NGS tools will provide some help when called with no arguments). Note that bwa is available both from the standard TACC module system and as BioContainers. module.

module load bwa
bwa

Program: bwa (alignment via Burrows-Wheeler transformation)
Version: 0.7.16a-r1181
Contact: Heng Li <lh3@sanger.ac.uk>

Usage:   bwa <command> [options]

Command: index         index sequences in the FASTA format
         mem           BWA-MEM algorithm
         fastmap       identify super-maximal exact matches
         pemerge       merge overlapping paired ends (EXPERIMENTAL)
         aln           gapped/ungapped alignment
         samse         generate alignment (single ended)
         sampe         generate alignment (paired ended)
         bwasw         BWA-SW for long queries

         shm           manage indices in shared memory
         fa2pac        convert FASTA to PAC format
         pac2bwt       generate BWT from PAC
         pac2bwtgen    alternative algorithm for generating BWT
         bwtupdate     update .bwt to the new format
         bwt2sa        generate SA from BWT and Occ

Note: To use BWA, you need to first index the genome with `bwa index'.
      There are three alignment algorithms in BWA: `mem', `bwasw', and
      `aln/samse/sampe'. If you are not sure which to use, try `bwa mem'
      first. Please `man ./bwa.1' for the manual.

As you can see, bwa include many sub-commands that perform the tasks we are interested in.

Building the BWA sacCer3 index

We will index the genome with the bwa index command. Type bwa index with no arguments to see usage for this sub-command.

Usage:   bwa index [options] <in.fasta>

Options: -a STR    BWT construction algorithm: bwtsw, is or rb2 [auto]
         -p STR    prefix of the index [same as fasta name]
         -b INT    block size for the bwtsw algorithm (effective with -a bwtsw) [10000000]
         -6        index files named as <in.fasta>.64.* instead of <in.fasta>.*

Warning: `-a bwtsw' does not work for short genomes, while `-a is' and
         `-a div' do not work not for long genomes.

Based on the usage description, we only need to specify two things:

• The name of the FASTA file  
• Whether to use the bwtsw or is algorithm for indexing

Since sacCer3 is relative large (~12 Mbp) we will specify bwtsw as the indexing option (as indicated by the "Warning" message), and the name of the FASTA file is sacCer3.fa.

The output of this command is a group of files that are all required together as the index. So, within our references directory, we will create another directory called references/bwa/sacCer3 and build the index there. To remind ourselves which FASTA was used to build the index, we create a symbolic link to our references/fasta/sacCer3.fa file (note the use of the ../.. relative path syntax).

mkdir -p $SCRATCH/core_ngs/alignment/fastq
mkdir -p $SCRATCH/core_ngs/references/fasta
cp $CORENGS/alignment/*fastq.gz $SCRATCH/core_ngs/alignment/fastq/
cp $CORENGS/references/*.fa $SCRATCH/core_ngs/references/fasta/

mkdir -p $SCRATCH/core_ngs/references/bwa/sacCer3
cd $SCRATCH/core_ngs/references/bwa/sacCer3
ln -s ../../fasta/sacCer3.fa
ls -l

Now execute the bwa index command.

bwa index -a bwtsw sacCer3.fa

Since the yeast genome is not large when compared to human, this should not take long to execute (otherwise we would do it as a batch job). When it is complete you should see a set of index files like this:

sacCer3.fa
sacCer3.fa.amb
sacCer3.fa.ann
sacCer3.fa.bwt
sacCer3.fa.pac
sacCer3.fa.sa

grep -P '^>' sacCer3.fa | wc -l

Or use grep's -c option that says "just count the line matches"

grep -P -c '^>' sacCer3.fa

Performing the bwa alignment
...