Alignment

Table of Contents

Overview and Objectives

Once raw sequence files are generated (in FASTQ format) and quality-checked, the next step in most NGS pipelines is mapping to a reference genome. For individual sequences of interest, it is common to use a tool like BLAST to identify genes or species of origin. However, a typical example NGS dataset may have tens to hundreds of millions of reads, which BLAST and similar tools are not designed to handle.

Thus, a large set of computational tools have been developed to quickly, and with sufficient (but not absolute) accuracy align each read to its best location, if any, in a reference. Even though many mapping tools exist, a few individual programs have a dominant "market share" of the NGS world. These programs vary widely in their design, inputs, outputs, and applications. In this section, we will primarily focus on two of the most versatile mappers: BWA and Bowtie2, the latter being part of the Tuxedo suite (e.g. transcriptome-aware Tophat2).

Sample Datasets

You have already worked with a paired-end yeast ChIP-seq dataset, which we will continue to use here.  The paired end data should already be located at:

$WORK/archive/original/2014_05.core_ngs

We will also use two additional RNA-seq datasets, which are located at:

$CLASSDIR/human_stuff

First copy the two human datasets to your $SCRATCH/core_ngs/fastq_prep directory.

cd $SCRATCH/core_ngs/fastq_prep
cp $CLASSDIR/human_stuff/*rnaseq.fastq.gz .

Create a $SCRATCH/core_ngs/align directory and make a link to the fastq_prep directory.

mkdir -p $SCRATCH/core_ngs/align
cd $SCRATCH/core_ngs/align
ln -s -f ../fastq_prep fq
ls -l 
ls fq

Reference Genomes

Before we get to alignment, we need a genome to align to.  We will use three different references here: 

• the human genome (hg19)
• the yeast genome (sacCer3)
• and mirbase (v20), human subset

Mirbase is a collection of all known microRNAs in all species. We will use the human subset of that database as our alignment reference.  This has the advantage of being significantly smaller than the human genome, while containing all the sequences we are actually interested in.

These are the three reference genomes we will be using today, with some information about them (and here is information about many more genomes):

Searching genomes, however, is hard work and takes a long time if done on an un-indexed, linear genomic sequence.  So, most aligners require that references be indexed for quick access  The aligners we are using each require a different index, but use the same method (the Burrows-Wheeler Transform) to get the job done.  This requires taking a FASTA file as input, with each chromosome (or contig) as a separate entry, and producing some aligner-specific set of files as output.  Then, those output files are used by the aligner when executing a given alignment command. Hg19 is way too big for us to index here, so we're not going to do it, and it's not included in the core_ngs_tools directory at Corral that we've been copying from.  Instead, all hg19 index files are located at:

/scratch/01063/abattenh/ref_genome/bwa/bwtsw/hg19

Now, we're going to grab the other two references, and we will build each index right before we use it in each set of exercise below.  These two references are located at:

/corral-repl/utexas/BioITeam/core_ngs_tools/references/sacCer3.fa
/corral-repl/utexas/BioITeam/core_ngs_tools/references/hairpin_cDNA_hsa.fa

Now, stage the yeast and mirbase reference fasta files in your scratch area in a directory called 'references'.

mkdir $SCRATCH/references
cp /corral-repl/utexas/BioITeam/core_ngs_tools/references/*.fa $SCRATCH/references

With that, we're ready to get started on the first exercise.

Exercise #1: BWA - Yeast ChIP-seq

Like other tools you've worked with so far, you first need to load bwa using the module system.  So, go ahead and do that now, and then enter 'bwa' with no arguments to view the help page.

module load bwa
bwa

As you can see, there are several commands one can use with bwa to do different things.  To test out one of them, we're going to index the genome with the 'index' command.  If you enter 'bwa index' with no arguments, you will see a list of the required arguments.  Here, we only need to specify two things: whether to use 'bwtsw' or 'is' indexing, and the name of the fasta file.  We will specify 'bwtsw' as the indexing option, and the name of the FASTA file is, obviously, sacCer3.fa.  The output of this command, importantly, is a group of files that are all required together as the index.  So, within the references directory, we will create another directory called "yeast", move the yeast FASTA file into that directory, and run the index commands from there:

cd $SCRATCH/references/
mkdir yeast
mv sacCer3.fa yeast
cd yeast
bwa index -a bwtsw sacCer3.fa

This command should produce a set of output files that look like this:

sacCer3.fa
sacCer3.fa.amb
sacCer3.fa.ann
sacCer3.fa.bwt
sacCer3.fa.pac
sacCer3.fa.sa

Now, we're ready to execute the actual alignment, with the goal of producing a SAM/BAM file from the input FASTQ files and reference.  We will first generate SAI files from each of the FASTQ files with the reference individually using the 'aln' command, then combine them (with the reference) into one SAM/BAM output file using the 'sampe' command.   We need a directory to put the alignments when they are finished, as well as any intermediate files, so create a directory called 'alignments'.  The command flow, all together, is as follows. Notice how each file is in its proper directory, which requires us to specify the whole file path in the alignment commands.

cds
mkdir alignments
bwa aln references/yeast/sacCer3.fa fastq_align/Sample_Yeast_L005_R1.cat.fastq.gz > alignments/yeast_R1.sai
bwa aln references/yeast/sacCer3.fa fastq_align/Sample_Yeast_L005_R2.cat.fastq.gz > alignments/yeast_R2.sai
bwa sampe references/yeast/sacCer3.fa alignments/yeast_R1.sai alignments/yeast_R2.sai fastq_align/Sample_Yeast_L005_R1.cat.fastq.gz fastq_align/Sample_Yeast_L005_R2.cat.fastq.gz > alignments/yeast_pairedend.sam

You did it!  In the alignments directory, there should exist the two intermediate files (the SAI files), along with the SAM file that contains the alignments.  It's just a text file, so take a look with head, more, less, tail, or whatever you feel like.  In the next section, with samtools, you'll learn some additional ways to analyze the data. BWA, however, is a lot more complex than the above commands let on.  If you look at the help pages for 'bwa aln' in particluar, there are numerous options that can increase the alignment rate (as well as decrease it), and all sorts of other things.  There are lots of options, but here is a summary of the most important ones.

The rest of the options control the details of how much a mismatch or gap is penalized, limits on the number of acceptable hits per read, and so on.  Much more information can be accessed at the BWA manual page.

Exercise #2: Bowtie2 and Local Alignment - Human microRNA-seq

Now we're going to switch over to a different aligner that was originally designed for very short reads, and is frequently used for RNA-seq data.  Accordingly, we have prepared a test microRNA-seq dataset for you to experiment with.  This data is derived from a human H1 embryonic stem cell (H1-hESC) small RNA dataset generated by the ENCODE Consortium (its about a half million reads).  However, there is a problem!  We don't know (or, well, you don't know) what the adapter structure or sequences were.  So, you have a bunch of 36 base pair reads, but many of those reads will include extra sequence that will impede alignment!  We need an aligner that can find subsections of the read that align, and discard (or "soft-clip") the rest away.  Bowtie2 is just such an aligner.  Go ahead and load it up so we can examine some help pages and options.  To do that, you must first load the "perl" module, and then the bowtie2 module designated "bowtie/2.2.0". 

module load perl
module load bowtie/2.2.0
bowtie2

Now that it's loaded, check out the options.  There are a LOT of them!  This is the key to using Bowtie2 - it allows you to control almost everything about its behavior, but that also makes it easier to screw things up.  Before getting to using the tool, though, we've got to build a mirbase index.  This requires using the command "bowtie2-build" - go ahead and check out its options.  Unlike for the aligner itself, we only need to worry about a few things here:

bowtie2-build <reference_in> <bt2_index_base>

Here, the reference_in file is just our FASTA file containing mirbase sequences, and the bt2_index_base is the prefix of where we want the files to go.  Following what we did earlier for BWA indexing:

cd $SCRATCH/references/
mkdir mirbase
mv hairpin_cDNA_hsa.fa mirbase
cd mirbase
bowtie2-build hairpin_cDNA_hsa.fa hairpin_cDNA_hsa.fa

That was very fast!  It's because the mirbase reference genome is so small compared to what programs like this are used to dealing with, which is the human genome (or bigger).  Now, your $SCRATCH/references/mirbase directory should be filled with the following files:

hairpin_cDNA_hsa.fa
hairpin_cDNA_hsa.fa.1.bt2
hairpin_cDNA_hsa.fa.2.bt2
hairpin_cDNA_hsa.fa.3.bt2
hairpin_cDNA_hsa.fa.4.bt2
hairpin_cDNA_hsa.fa.rev.1.bt2
hairpin_cDNA_hsa.fa.rev.2.bt2

Now, we're ready to actually try to do the alignment.  Remember, unlike BWA, we actually need to set some options depending on what we're after.  These are the most important options when using Bowtie2:

To decide how we want to go about doing our alignment, check out the file we're aligning with 'less'.

cds
less fastq_align/human_mirnaseq.fastq.gz

Lots of those reads have long strings of A's, which must be an adapter or protocol artifact.  Even though we see how we might be able to fix it using some tools we've talked about, what if we had no idea what the adapter sequence was, or couldn't use cutadapt or other programs to prepare the reads?  In that case, we need a local alignment where the seed length is the small boundary of the acceptable internal alignments. Here, we are interested in finding any sections of any reads that align well to a microRNA.  These sequences are between 16 and 22 bases long, so any good alignment should have at least 16 matching bases, but could have more.  Also, maybe we want to allow a mismatch or two in the seed, since we might be interested in miRNA SNPs.  So, a good set of options might look something like this:

-N 1 -L 16 --local

This leaves the default scoring method as "-ma 2", meaning that a 16 base pair alignment will have a score of 32, and so on.  This is VERY different from the alignment scores assigned by other aligners, so it's worth remembering.

As you can tell from looking at the Bowtie2 help message, the syntax looks like this:

bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r>} [-S <sam>]

As such, our alignment command (now that we have the FASTQ file and the reference sequence ready) could be this (make sure you are located in your scratch directory!):

cds
bowtie2 -N 1 -L 16 --local -x references/mirbase/hairpin_cDNA_hsa.fa -U fastq_align/human_mirnaseq.fastq.gz -S alignments/human_mirnaseq.sam

Now, you should have a human_mirnaseq.sam file in your alignments directory, that you can check out using whatever commands you like.  An example alignment looks like this:

TUPAC_0037_FC62EE7AAXX:2:1:2607:1430#0/1        0       hsa-mir-302b    50      22      3S20M13S        *       0       0       TACGTGCTTCCATGTTTTANTAGAAAAAAAAAAAAG    ZZFQV]Z[\IacaWc]RZIBVGSHL_b[XQQcXQcc    AS:i:37 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:16G3       YT:Z:UU

Note how the CIGAR string is 3S20M13S, meaning that 13 bases were soft clipped from one end, and 3 from the other.  If we did the same alignment using either --end-to-end mode, or using BWA in the same way as we did in Exercise #1, very little of this file would have aligned.  However, if we had not lowered the seed parameter of Bowtie2 from its default of 22, we would not have found many of the alignments like the one shown above, because the read only matched for 20 bases - a matching 22 base seed does not exist.  Such is the nature of Bowtie2 - it can be a powerful tool to sift out the alignments you want from a messy dataset with limited information, but doing so requires careful tuning of the parameters, which can in itself take a lot of time to perfect.

Exercise #3: BWA-MEM (and Tophat2) - Human mRNA-seq

After Bowtie2 came out with a local alignment option, it wasn't long before BWA generated their own local-aligner called BWA-MEM (for Maximal Exact Matches).  This aligner is very, very nice because it incorporates a lot of the simplicity of using BWA with the complexities of local alignment.  This functionality, while enabling the alignment of datasets like the mirbase data we just examined, also permits more complex alignments, such as that of spliced mRNAs.  In a long RNA-seq experiment, reads will (at some frequency) span a splice junction themselves, or a pair of reads in a paired-end library will fall on either side of a splice junction.  We want to be able to align reads that do this for many reasons, from accurate transcript quantification to novel fusion transcript discovery.  Thus, our last exercise will be the alignment of a human LONG RNA-seq dataset composed (by design) almost exclusively of reads that cross splice junctions.

BWA-MEM should have been loaded when we loaded the BWA module, so to look at the details of MEM alignment, just enter "bwa mem" to get the help menu with the options list.  The most important parameters, similar to those we've manipulated in the past two sections, are the following:

There are many more parameters to control the scoring scheme and other details, but these are the most essential parameters to use to get anything of value at all.

The test file we will be working with is JUST the R1 file from a paired-end total RNA-seq experiment, meaning it is (for our purposes) single-end.  Go ahead and take a look at it, and find out how many reads are in the file.

cds
less fastq_align/human_rnaaseq.fastq.gz
gunzip -c fastq_align/human_rnaseq.fastq.gz | echo $((`wc -l`/4))

Now, try aligning it with BWA like we did in example 1.  This won't take very long, but you'll need to use our pre-indexed hg19 reference.  It is located at:

/scratch/01063/abattenh/ref_genome/bwa/bwtsw/hg19.fa

if you look at the contents of the 'bwtsw' directory in the above path, you'll see a set of files that are analogous to the yeast files we created earlier, except that their universal prefix is 'hg19.fa'.  Now, using that index, go ahead and try to do a single-end alignment of the file to the human genome like we did in Exercise #1, and save the contents to intermediate files with the prefix 'human_rnaseq_bwa'.

cds
bwa aln /scratch/01063/abattenh/ref_genome/bwa/bwtsw/hg19/hg19.fa fastq_align/human_rnaseq.fastq.gz > alignments/human_rnaseq_bwa.sai
bwa samse /scratch/01063/abattenh/ref_genome/bwa/bwtsw/hg19/hg19.fa alignments/human_rnaseq_bwa.sai fastq_align/human_rnaseq.fastq.gz > alignments/human_rnaseq_bwa.sam

Now, use less to take a look at the contents of the sam file, using the space bar to leaf through them.  You'll notice a lot of alignments look basically like this:

HWI-ST1097:228:C21WMACXX:8:1316:10989:88190     4       *       0       0       *       *       0       0
       AAATTGCTTCCTGTCCTCATCCTTCCTGTCAGCCATCTTCCTTCGTTTGATCTCAGGGAAGTTCAGGTCTTCCAGCCGCTCTTTGCCACTGATCTCCAGCT
   CCCFFFFFHHHHHIJJJJIJJJJIJJJJHJJJJJJJJJJJJJJIIIJJJIGHHIJIJIJIJHBHIJJIIHIEGHIIHGFFDDEEEDDCDDD@CDEDDDCDD

meaning they are not alignments at all.  Essentially, nothing (with a few exceptions) aligned.  That's because this file was generated exclusively from reads in a larger dataset that cross at least one splice junction (surprise!), meaning that they sequence as it exists in most of the reads does not exist anywhere in the genome, but some subsections of each read do exist somewhere in the genome.  So, we need an aligner that is capable of finding regions of each read (above some length cutoff) that align to the genome.  Based on the following syntax, and using the reference path, we noted earlier, try to use BWA MEM to align the same file, single-end, saving all output files with the prefix 'human_rnaseq_mem':

bwa mem ref.fa reads.fq > aln-se.sam

bwa mem /scratch/01063/abattenh/ref_genome/bwa/bwtsw/hg19/hg19.fa fastq_align/human_rnaseq.fastq.gz > alignments/human_rnaseq_mem.sam

Now, check the length of the SAM file you generated with 'wc -l'.  Since there is one alignment per line, there must be 586266 alignments, which is more than the number of sequences in the FASTQ file.  This is because many reads will align twice or more, hopefully on either side of a splice junction.  These alignments can still be associated because they will have the same read ID, but are reflected in more than one line.  To get an idea of how often each read aligned, and what the 'real' alignment rate is, use the following commands:

cut -f 1 alignments/human_rnaseq_mem.sam | sort | uniq -c | less	#This gives you a view where each read is listed next to the number of entries it has in the SAM file
cut -f 1 alignments/human_rnaseq.sam | sort | uniq -c | awk '{print $1}' | sort | uniq -c | less	#This gives essentially a histogram of the number of times each read aligned - a plurality of reads aligned twice, which seems reasonable since these are all reads crossing a junction, but plenty aligned more or less
cut -f 1 alignments/human_rnaseq.sam | sort | uniq | wc -l	#This gives a better idea of the alignment rate, which is how many reads aligned at least once to the genome.  Divided by the number of reads in the original file, the real alignment rate is around 64.19 %.

# PLEASE NOTE: some of these one-liners are only reasonably fast if the files are relatively small (around a million reads or less).  For bigger files, there are better ways to get this information, mostly using samtools, which is a utility explicitly designed for manipulating SAM/BAM files.  We'll cover samtools in the next section.

If you want to be able to generate a file with only the best (for BWA MEM, that means the longest) alignment for each read, so that every read can only be represented by one line, the option -M will add a flag to the end of each alignment entry that designates any alignments that are not the longest for their originating read as secondary.  Then, you can filter all reads that do not have that flag.

This alignment rate is pretty good, but it could get better by playing around with the finer details of BWA MEM.  It is also a bit higher if you use an aligner that is more explicitly concerned with sensitivity to splice sites, namely a program like Tophat2.  All Tophat programs use Bowtie or Bowtie2 as the actual aligner, but split up each read into smaller pieces to align individually, then tries to reconstruct reasonable overall alignments from the pieces.  In fact, these reads can all be aligned by using Tophat2 with the right parameters.