...
- H54_miRNA_L004.cuta.log, H54_miRNA_L005.cuta.log, yeast_rnaseq.cuta.log
- these are the main execution log files, one for each trim_adapters.sh command
- H54_miRNA_L004.acut.pass0.log, H54_miRNA_L005.acut.pass0.log
- these are cutadapt statistics files for the single-end adapter trimming
- their contents will look like our small example above
- yeast_rnaseq.acut.pass1.log, yeast_rnaseq.acut.pass2.log
- these are cutadapt statistics files from trimming the R1 and R2 adapters, respectively.
Take a look at the first 13 17 lines of the yeast_rnaseq.acut.pass1.log log file:
| Expand |
|---|
|
| Code Block |
|---|
| head -1317 yeast_rnaseq.acut.pass1.log |
|
...
| Code Block |
|---|
|
This is cutadapt 1.1018 with Python 23.7.121
Command line parameters: -m 32 -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC --trim-n --paired-output yeast_rnaseq_R2.tmp.cuta.fastq -o yeast_rnaseq_R1.tmp.cuta.fastq Yeast_RNAseq_L002_R1.fastq.gz Yeast_RNAseq_L002_R2.fastq.gz
Trimming 1 adapter with at most 10.0% errors in paired-end legacy mode ...Processing reads on 1 core in paired-end legacy mode ...
WARNING: Legacy mode is enabled. Read modification and filtering options
*ignore* the second read. To switch to regular paired-end mode,
provide the --pair-filter=any option or use any of the
-A/-B/-G/-U/--interleaved options.
Finished in 126151.0554 s (2024 us/read; 32.0755 M reads/minute).
=== Summary ===
Total read pairs processed: 6,440,847
Read 1 with adapter: 3,875,741 (60.2%)
Read 2 with adapter: 0 (0.0%)
Pairs that were too short: 112,845847 (1.8%)
Pairs written (passing filters): 6,328,002000 (98.2%)
|
- cutadapt started with 6,440,847 read pairs
- 112,845 847 reads were discarded as too short after the R1 adapter was removed
- the same 112,845 847 reads were discarded from both the R1 and R2 files
- the remaining 6,328,002 000 were then subjected to pass2 processing.
...
| Code Block |
|---|
|
ls5:/scratch/01063/abattenh/core_ngs/cutadapt$ head -13 yeast_rnaseq.acut.pass2.log
This is cutadapt 1.1018 with Python 23.7.121
Command line parameters: -m 32 -a TGATCGTCGGACTGTAGAACTCTGAACGTGTAGA --paired-output yeast_rnaseq_R1.cuta.fastq -o yeast_rnaseq_R2.cuta.fastq yeast_rnaseq_R2.tmp.cuta.fastq yeast_rnaseq_R1.tmp.cuta.fastq
TrimmingProcessing 1reads adapteron with at most 10.0% errors1 core in paired-end legacy mode ...
Finished in 9783.4064 s (1513 us/read; 34.9054 M reads/minute).
=== Summary ===
Total read pairs processed: 6,328,002000
Read 1 with adapter: 90,848 (1.4%)
Read 2 with adapter: 0 (0.0%)
Pairs that were too short: 0 (0.0%)
Pairs written (passing filters): 6,328,002,000 (100.0%)
Total basepairs processed: 1,198,172,994 bp
Read 1: 639,128,000 bp
Read 2: 559,044,994 bp
Total written (filtered): 1,197,894,462 bp (100.0%) |
- cutadapt started with 6,328,002 000 pass1 reads
- no additional reads were discarded as too short after the R2 adapter was removed
- so new R1 and R2 files, both with 6,328,002 000 reads, were produced
- yeast_rnaseq_R1.cuta.fastq.gz and yeast_rnaseq_R2.cuta.fastq.gz
Exercise: Verify that both adapter-trimmed yeast_rnaseq fastq files have 6,328,002 000 reads
| Expand |
|---|
|
| Code Block |
|---|
| echo "$((`zcat yeast_rnaseq_R1.cuta.fastq.gz | wc -l` / 4))"
zcat yeast_rnaseq_R2.cuta.fastq.gz | wc -l | awk '{print $1/4}' |
|
...