Now that we have a bam file with only the reads we want included, we can do some more sophisticated analysis using bedtools. Bedtools changes from version to version, and here we are using version 2.22, the newest version, and what is currently installed on stampede. You can check what versions of bedtools are installed by using the following command on stampede:
First, log on to the login8 node on stampede and make a directory in scratch called bedtools in your scratch folder. Then copy your filtered bam file from the samtools section into this folder.
ssh user@login8.stampede.tacc.utexas.edu #if you are not already logged in!
cds
mkdir bedtools
cd samtools
cp yeast_pairedend_sort.mapped.q1.bam ../bedtools
cd ../bedtools
Sometimes, especially when working with external data, we need to go from a bam file back to a fastq file. This can be useful for re-aligning reads using a different aligner, different settings on the original aligner used. It can also be useful for extracting the sequence of interesting regions of the genome after you have manipulated your bam file.
For this exercise, you'll be using bamtofastq. This function takes an aligned bam file as input and outputs a fastq format file. You can use the options if you have paired end data to output R1 and R2 reads for your fastq file. This type of function is especially useful if you need to to analyze sequences after you've compared several bam or bed files.
bedtools bamtofastq -i input.bam -fq output.fastq
Exercise 1: convert bam to fastq and look at the quality scores
click here to see the code and output
module load bedtools
bedtools bamtofastq -i yeast_pairedend_sort.mapped.q1.bam -fq yeast_pairedend_sort.mapped.q1.fastq #takes 1-2 minutes
more yeast_pairedend_sort.mapped.q1.fastq
Here is an example of two sequences (and their corresponding quality scores):
@HWI-ST1097:127:C0W5VACXX:5:2212:10568:79659
TACCCTCCAATTACCCATATCCAACCCACTGCCACTTACCCTACCATTACCCTACCATCCACCATGACCTACTCACCATACTGTTCTTCTACCCACCATAT
+
CCCFFFFFHHHHHJJJJJIIJJJJIJJIJJIJJIIIIJJJIJJIJJIJJIJJJJJJJJJJIIGGIGEGAEHFEFFEFFFDEEE@CCEDCDDD>ACBBDCA@
@HWI-ST1097:127:C0W5VACXX:5:2115:19940:13862
TAGGGTAAGTTTGAGATGGTATATACCCTACCATCCACCATGACCTACTCACCATACTGTTCTTCTACCCACCATATTGAAACGCTAACAAATGATCGTAA
+
?B@DF2ADHFHHFHJIIIGCIHIGGIJJJJGHIIIGIJEHHIGGGAHEGGFGHIECGIJIIIJIIIIIJJJJJJE>EHDHEEEBCDD?CDDBDDDDDDCDB
As we discussed earlier, the top line is the identifier for the sequence produced, the second line defines which bases were produced, the third line indicates the strand the sequence is aligned to, and the fourth line indicates the ASCII based quality scores for each character in the second line.
While it's useful to be able to look at the fastq file, many analyses will be easiest to perform in bed format. Bed format is a simple tab delimited format that designates various properties about segments of the genome, defined by the chromosome, start coordinates and end coordinates. Bedtools provides a simple utility to convert bam files over into bed files, termed bamtobed.
bedtools bamtobed -i input.bam > output.bed #output to a file
bedtools bamtobed -i input.bam | more #output to more
Note that the output will be piped to standard out unless you redirect to a program (head, more, less) or a file (output.bed). Now we'll put this example to use and convert our filtered bam file from the samtools section into a bed file.
Exercise 2: Convert the filtered yeast paired end bam to bed using bamtobed, look at your file in more, and find the number of lines in the file
Hint: direct the output to a file first, then use more to look at the converted file visually; use ctrl+c to quit more.
click to see the code and output
module load bedtools #if you haven't loaded it in for this session
bedtools bamtobed -i yeast_pairedend_sort.mapped.q1.bam > yeast_pairedend_sort.mapped.q1.bed
more yeast_pairedend_sort.mapped.q1.bed #to examine the bed file visually
wc -l yeast_pairedend_sort.mapped.q1.bed #to get the number of lines in a file
Here is what my output looks like:
wc -l yeast_pairedend_sort.mapped.q1.bed
528976 yeast_pairedend_sort.mapped.q1.bed
more yeast_pairedend_sort.mapped.q1.bed
chrI 219 320 HWI-ST1097:127:C0W5VACXX:5:2212:10568:79659/1 37 +
chrI 266 344 HWI-ST1097:127:C0W5VACXX:5:2115:19940:13862/2 29 +
chrI 368 469 HWI-ST1097:127:C0W5VACXX:5:2115:19940:13862/1 29 -
chrI 684 785 HWI-ST1097:127:C0W5VACXX:5:2212:10568:79659/2 37 -
chrI 871 955 HWI-ST1097:127:C0W5VACXX:5:1103:4918:43976/2 29 +
chrI 871 948 HWI-ST1097:127:C0W5VACXX:5:1104:2027:42518/2 29 +
chrI 871 948 HWI-ST1097:127:C0W5VACXX:5:1109:3153:38695/2 29 +
chrI 871 948 HWI-ST1097:127:C0W5VACXX:5:2109:6222:11815/2 29 +
chrI 871 948 HWI-ST1097:127:C0W5VACXX:5:2113:5002:59471/2 29 +
chrI 871 948 HWI-ST1097:127:C0W5VACXX:5:2113:7803:87146/2 29 +
chrI 971 1072 HWI-ST1097:127:C0W5VACXX:5:1103:4918:43976/1 29 -
chrI 978 1079 HWI-ST1097:127:C0W5VACXX:5:1104:2027:42518/1 29 -
chrI 978 1079 HWI-ST1097:127:C0W5VACXX:5:1109:3153:38695/1 29 -
chrI 978 1079 HWI-ST1097:127:C0W5VACXX:5:2109:6222:11815/1 29 -
chrI 978 1079 HWI-ST1097:127:C0W5VACXX:5:2113:5002:59471/1 29 -
chrI 978 1079 HWI-ST1097:127:C0W5VACXX:5:2113:7803:87146/1 29 -
chrI 978 1079 HWI-ST1097:127:C0W5VACXX:5:2203:1231:50183/1 37 -
Note the "stacks" of reads that are occuring on similar coordinates on the same strand of the genome. We'll deal with those in the bedtools merge section.
One way of characterizing data is to understand what percentage of the genome your data covers. What type of experiment you performed should affect the coverage of your data. A ChIP-seq experiment will cover binding sites, and a RNA-seq experiment will cover expressed transcripts. Bedtools coverage allows you to compare one bed file to another and compute the breadth and depth of coverage.
bedtools coverage -a experiment.bed -b reference_file.bed
The resulting output will contain several additional columns which summarize this information:
bedtools coverage output
After each interval in B, coverageBed will report:
- The number of features in A that overlapped (by at least one base pair) the B interval.
- The number of bases in B that had non-zero coverage from features in A.
- The length of the entry in B.
- The fraction of bases in B that had non-zero coverage from features in A.
For this exercise, we'll use a bed file that summarizes the S. cerevisiae genome, version 3 (aka sacCer3). For this class, I've made a bed file out of the genome, using the file sacCer3.chrom.sizes. First go and copy the file over from my scratch directory:
cd bedtools #if you aren't already there
cp /scratch/01786/awh394/core_ngs/day4_2015/sacCer3.chrom.sizes.bed .
Use more to take a quick look at the file...
more sacCer3.chrom.sizes.bed
chrIV 1 1531933
chrXV 1 1091291
chrVII 1 1090940
chrXII 1 1078177
chrXVI 1 948066
chrXIII 1 924431
chrII 1 813184
chrXIV 1 784333
chrX 1 745751
chrXI 1 666816
chrV 1 576874
chrVIII 1 562643
chrIX 1 439888
chrIII 1 316620
chrVI 1 270161
chrI 1 230218
chrM 1 85779
The format is bed3 - just chrom, start (which is always 1) and stop, which is always the length of the chromosome, for this type of bed file.
Now use bedtools coverage to find the coverage of the file output.bed over the sacCer3 genome and examine the output coverage.
Exercise 3: Find the coverage of your bed file over the sacCer3 genome
click here to see the code for bedtools coverage
module load bedtools #again, if not already loaded
bedtools coverage -a yeast_pairedend_sort.mapped.q1.bed -b sacCer3.chrom.sizes.bed > sacCer3coverage.bed
more sacCer3coverage.bed #this file should have 17 lines, one for each chromosome
And here is what my output looks like:
more sacCer3coverage.bed
chrI 1 230218 7972 128701 230217 0.5590421
chrII 1 813184 35818 539222 813183 0.6631004
chrIII 1 316620 13701 199553 316619 0.6302623
chrIV 1 1531933 70633 1026387 1531932 0.6699951
chrIX 1 439888 15953 276571 439887 0.6287319
chrM 1 85779 3264 58599 85778 0.6831472
chrV 1 576874 26918 381078 576873 0.6605926
chrVI 1 270161 10662 167222 270160 0.6189740
chrVII 1 1090940 49762 722821 1090939 0.6625677
chrVIII 1 562643 23424 356421 562642 0.6334774
chrX 1 745751 30743 472357 745750 0.6333986
chrXI 1 666816 27950 446567 666815 0.6697015
chrXII 1 1078177 48155 658373 1078176 0.6106359
chrXIII 1 924431 40054 618798 924430 0.6693833
chrXIV 1 784333 32565 513382 784332 0.6545468
chrXV 1 1091291 47871 710376 1091290 0.6509507
chrXVI 1 948066 43531 612122 948065 0.6456540
When we originally examined the bed files produced from our bam file, we can see many reads that overlap over the same interval. While this level of detail is useful, for some analyses, we can collapse each read into a single line, and indicate how many reads occured over that genomic interval. We can accomplish this using bedtools merge.
bedtools merge [OPTIONS] -i experiment.bed > experiment.merge.bed
Bedtools merge also directs the output to standard out, to make sure to point the output to a file or a program. While we haven't discussed the options for each bedtools function in detail, here they are very important. Many of the options define what to do with each column (-c) of the output (-o). This defines what type of operation to perform on each column, and in what order to output the columns. Standard bed6 format is chrom, start, stop, name, score, strand and controlling column operations allows you to control what to put into each column of output. The valid operations defined by the -o operation are as follows:
valid operations using the -o option
- sum, min, max, absmin, absmax,
- mean, median,
- collapse (i.e., print a delimited list (duplicates allowed)),
- distinct (i.e., print a delimited list (NO duplicates allowed)),
- count
- count_distinct (i.e., a count of the unique values in the column)
For this exercise, we'll be summing the number of reads over a region to get a score column, using distinct to choose a name, and using distinct again to keep track of the strand. For the -c options, define which columns to operate on, in the order you want the output. In this case, to keep the standard bed format, we'll list as -c 5,4,6 and -o count_distinct,sum,distinct, to keep the proper order of name, score, strand. Strandedness can also be controlled with merge, using the -s option.
Exercise 4: Use bedtools merge to merge an experiment, look at the output and see how many lines there are in the file.
Hint: make sure to remove whitespace between lists for the -c and -o options!
click here to see the bedtools merge code and output
bedtools merge -s -c 4,5,6 -o count_distinct,sum,distinct -i yeast_pairedend_sort.mapped.q1.bed > yeast_pairedend_sort.mapped.q1.merge.bed
more yeast_pairedend_sort.mapped.q1.merge.bed
wc -l yeast_pairedend_sort.mapped.q1.merge.bed
wc -l yeast_pairedend_sort.mapped.q1.merge.bed
40319 yeast_pairedend_sort.mapped.q1.merge.bed #without the -s option
76601 yeast_pairedend_sort.mapped.q1.merge.bed #with the -s option
more yeast_pairedend_sort.mapped.q1.merge.bed
chrI 219 344 2 66 +
chrI 368 469 1 29 -
chrI 684 785 1 37 -
chrI 871 955 6 174 +
chrI 971 1079 7 211 -
chrI 1216 1322 6 157 +
chrI 1347 1437 6 157 -
chrI 2892 2993 14 406 +
chrI 3010 3111 1 37 +
chrI 3013 3107 14 406 -
One useful way to compare two experiments (especially biological replicates, or similar experiments in two yeast strains/cell lines/mouse strains) is to compare where reads in one experiment overlap with reads in another experiment. Bedtools offers a simple way to do this using the intersect function.
bedtools intersect [OPTIONS] -a <FILE> \
-b <FILE1, FILE2, ..., FILEN>
The intersect function has many options that control how to report the intersection. We'll be focusing on just a few of these options, listed below.
-a and -b indicate what files to intersect. in -b, you can specify one, or several files to intersect with the file specified in -a.
bedtools intersect options
- wa: Write the original entry in A for each overlap.
- wb: Write the original entry in B for each overlap. Useful for knowing what A overlaps. Restricted by -f and -r.
- loj: Perform a “left outer join”. That is, for each feature in A report each overlap with B. If no overlaps are found, report a NULL feature for B.
- wo: Write the original A and B entries plus the number of base pairs of overlap between the two features. Only A features with overlap are reported. Restricted by -f and -r.
- wao: Write the original A and B entries plus the number of base pairs of overlap between the two features. However, A features w/o overlap are also reported with a NULL B feature and overlap = 0. Restricted by -f and -r.
- f: Minimum overlap required as a fraction of A. Default is 1E-9 (i.e. 1bp).
- v: Only report those entries in A that have no overlap in B. Restricted by -f and -r. Useful to report what doesn't overlap, the inverse of typical usage.
- names: When using multiple databases (-b), provide an alias for each that will appear instead of a file Id when also printing the DB record.
In this section, we'll intersect two human experiments - one from sequencing RNA, and one from sequencing miRNA. Copy these files over to your directory:
cds
mkdir intersect
cd intersect
cp /scratch/02423/nsabell/core_ngs/alignment/bam/human_rnaseq_bwa.bam .
cp /scratch/02423/nsabell/core_ngs/alignment/bam/human_mirnaseq_hg19.bam .
click here to see my output on copying files
-rwxrwxr-x 1 awh394 G-801021 19M May 27 14:17 human_mirnaseq_hg19.bam
-rwxrwxr-x 1 awh394 G-801021 6.6M May 27 14:17 human_rnaseq_bwa.bam
Before we can intersect these files, we need to perform the pipeline we used in samtools to index, sort and filter the files, and also convert over to bed and collapse down the files using merge. Below is a little workflow to help you through it on the files you just copied above.
Click here to see the samtools/bedtools workflow
module load samtools #if you haven't loaded it up this session
#sort both files
samtools sort human_mirnaseq_hg19.bam human_mirnaseq_hg19_sort # will take 1-2 minutes
samtools sort human_rnaseq_bwa.bam human_rnaseq_bwa_sort # will take 1-2 minutes
#index the new files
samtools index human_mirnaseq_hg19_sort.bam
samtools index human_rnaseq_bwa_sort.bam
#filter the sorted files, reindex the new filtered files
samtools view -F 0x04 -q 1 -o human_mirnaseq_hg19_sort.mapped.q1.bam human_mirnaseq_hg19_sort.bam
samtools view -F 0x04 -q 1 -o human_rnaseq_bwa_sort.mapped.q1.bam human_rnaseq_bwa_sort.bam
samtools index human_mirnaseq_hg19_sort.mapped.q1.bam
samtools index human_rnaseq_bwa_sort.mapped.q1.bam
#convert filtered bam files to bed format
module load bedtools #if you haven't loaded it in for this session
bedtools bamtobed -i human_mirnaseq_hg19_sort.mapped.q1.bam > human_mirnaseq_hg19_sort.mapped.q1.bed
bedtools bamtobed -i human_rnaseq_bwa_sort.mapped.q1.bam > human_rnaseq_bwa_sort.mapped.q1.bed
#check the length of the files:
wc -l *.bed
#merge the bed files, check the length again
Exercise 5: Intersect two experiments using intersect and examine the output
click here for the bedtools intersect code and output
cd intersect
module load bedtools #if you haven't loaded it up yet this session
bedtools intersect -wao -a -b output.merge.bed > intersect.bed
wc -l intersect.bed
more intersect.bed
Using the options we've specified (-wao) the resulting file will have entries for file A, file B and the number of base pairs overlap between the feature in A and the features in B.